Michael Shanks interview, MMORPG doom and Stargate Universe trailer

07 Sep 2009
3 Comments »

In my last post I wrote about the upcoming MMORPG Stargate Worlds. It will be interesting to see what happens and if the project is dead in the water or not – further research shows news of funding issues, staff cuts and shoddy ‘craftsmanship’. Even in the below interview with Michael Shanks he refers the the growth of the Stargate Franchise beyond the series with movies and ‘failed video games’.

Another cool Stargate related thing is the theatrical trailer for Stargate Universe was released over the weekend. I’m interested to see how this show pans out – it looks at first glance to be a darker show with more of a space drama feel: think Stargate cross Battlestar Galactica. It even has a Battlestar Galactica-esque premise: A bunch of explorers from a variety of backgrounds and nationalities are stuck on a spaceship roaming the ether, with no way of returning home. The spaceship in question is an Ancient ship on autopilot that is seeding stargates across a distant galaxy.

Check the trailer here:

Pass the open source please and a torrent of sociability

05 Sep 2009
No Comments »

I’ve come across a number of cool sites and projects over the last week, as well as read a number of really thought provoking articles so I figured that I would filter for the best (in my mind) and put them up here.

1. Hexagon.cc

Picture 1

A torrent search engine / tracker site that has a definite social media feel and focus – which is pretty trendy at the moment.

Apparently the site is foundered by, amongst others, one of the admins of the large torrent search engine IsoHunt. Hexagon.cc looks really interesting as it will allow people to start up their own social-sharing networks for torrents and videos. The site is really cleanly designed and seems to be focusing on the convenient sharing of torrent information for legitimate material. Looks really promising!

http://hexagon.cc

2. OS FLV (and FlowPlayer)

OSFLV.com

The open source, embeddable FLV player.

This player is great for embedding your own video content on your site or blog, without hosting your video material on a third-party website such as YouTube or Vimeo. Whilst I have no problem with either of those services (I use both quite regularly) sometimes it is nice to have your video hosted locally, and have more control over how it is played back (you can have videos start automatically, loop and even customise the ’static image’).

Another player that looks great (maybe even better) is FlowPlayer, but I’ve not played around with it too much yet.

http://www.osflv.com
http://www.flowplayer.org

3. Zero-S Electric Motorcycle

zeromotorcycles.com

Fully-electric street legal motorcycle.

Fairly-decent max speed (90kph) and mid-range ‘mileage’ (~80km) makes this look like a really promising green motorcycle solution. At that range and top speed it would be a pretty decent bike for intra-city riding, not so good for inter-city, given that most highways in Australia have a limit of about 100-110kph). Give it a few years and I imagine we’ll see bikes with highway compatible top speeds and a longer range. It takes about 4 hours to recharge – what I would like to see is ‘battery exchange programs’ at fuel stations for electric bikes.

http://www.zeromotorcycles.com/zero-s-specs.php

4. Stargate Worlds

stargateworlds.com

Being a big Stargate fan I was stoked to find out recently that their was an MMORPG being made for the Stargate universe! It looks as though it is in beta too, with a tabled release of 2009. I might even consider getting a Windows box up and running to play this game, reviews pending.

http://www.stargateworlds.com/

Aaand some interesting articles (ripped from Twitter)

Linux (and OSX) commands for working with FASTA files

02 Sep 2009
19 Comments »

When working with the genomics or molecular marker side of BIoinformatics, Bioinformaticians are faced (very) often with DNA (or RNA) sequence files in FASTA format. FASTA files can store a single sequence, or multiple sequences. To be able to access individual sequences or measure some metric of the sequence data, such as length, some form of manipulation of the files is usually required.

This post gives a set of unix commands to perform some common manipulations required of FASTA files. These commands should work using the BASH shell under most popular distributions of linux (I use Ubuntu and CentOS). They will also work in the OSX terminal and *SHOULD* work in Windows using software such as Cygwin.

The manipulations and metric measurements I cover in this article deal with:

  1. Splitting a FASTA file of multiple sequences into FASTA files of individual sequences
  2. Joining multiple FASTA files into a single, multi-sequence FASTA file
  3. List the sequence headers in a FASTA file
  4. Counting the number of sequence entities in a FASTA file
  5. Determining the length of the sequence in a FASTA file

BEFORE WE BEGIN
Where you see or (or a similar name in angled brackets), replace this with your input file of choice or the name of the output file you wish to create respectively.

The FASTA Format

sourced from http://www.nmpdr.org/

To give a super brief description, FASTA format was the ASCII file format used for sequence information for the application of the same name. Some time in bioinformatics world passed and now FASTA formatted files are used by a variety of Bioinformatics packages and is the de facto standard for storing sequence information in text files.

The FASTA format itself is very simple: A file can consist of one or more sequence elements, each headed by a free text header starting with the chevron ‘>’ character and ending with a newline ‘\n’ character.

e.g. for DNA sequence:

>sequence 1
ACCGTACGATACGATCGCATCGCTGACTCG
ACTTACGACGACGCANNNNACATCGATCGA
ACACTCAGCA
>sequence 2
CACGCATTATCATCGATCCTCAGCTCATCGA
ATACGTACCACAACTCGCATCTCAGTCAGAC
ACTCGTACGCTACGTACGCATGCATCAGATC
ATCCTATGCATGCATCGTACGCTAGACTCGA
ATCGATCGCATGCATACGTACGCAT

NOTE: The sequence itself may have newline characters throughout the sequence – these should be
stripped when using the sequence data.

Splitting a FASTA file of multiple sequences into FASTA files of individual sequences

This command will create as many files as there are member sequences in the same directory as the source file,
incrementally numbered with a .fasta extension. (e.g. for an input file with 5 member sequences, such as the Arabidopsis genome, it will output files 1.fasta to 5.fasta.

awk '/^>/{f=++d".fasta"} {print > f}' <inputFile>

Joining multiple FASTA files into a single, multi-sequence FASTA file

This is the reverse of the above and we will assume a few things. Firstly, you want to combine all fasta files in the current directory and, secondly, they all have the same extension (.fasta). Adapt to your needs if this is not the case!

cat *.fasta > <outputFile>

List the sequence headers in a FASTA file

grep ">" <inputFile>

Counting the number of sequence entities in a FASTA file

grep ">" <inputFile> | wc -l

Determining the length of the sequence in a FASTA file

This method will give the TOTAL sequence length of a FASTA file. This means that if your FASTA file has a number of sequence entries, it will return the sum of the length of each sequence entry. To get the length of individual entries you would first need to split the file into individual entries, or do it programatically: either using a homegrown method or a Bioinformatics library such as BioPerl.

grep -v ">" <inputFile> | tr -d [:space:] | wc -c

These are a few useful commands for performing some common and simple FASTA file manipulations without needing to resort to programatic methods. It may be worthwhile defining an alias or simple bashscript wrapper for the above commands, allowing you to type something like: fastaLength fastafile.fasta at the command line.

Cognicology re-revamp, wireframes and smashing books

01 Sep 2009
1 Comment »

book-3d-320pxIt’s been pretty hectic with the PhD and Cognicology.com this month: I’m trying to wrangle a trip over to the states in January for a conference related to my PhD, which has taken a fair amount of my time. It is amazing the loops you need to jump through to organise this sort of thing. Between trying to secure a talking position, apply for travel funding and contacting other institutes to visit and talk sciencey things with, I’ve been kept pretty busy. Adding to that, Alborz and I have also been pretty busy with organising and preparing videos for the Cognicology.com site which has been a blast. As exciting as my day-to-day life is (assuming exciting is a relative measure, and you consider paint drying to be an extreme sport) it isn’t really the reason for this post.

The new Cognicology.com design has been up for about a month now, and whilst the design is a definite improvement over the last design, it still isn’t our ideal layout. I actually had a meeting with Al today about the design of the site and we’ve both come to the conclusion that we want something that is a little more ‘full and exciting’ and a lot less minimalist. At around the same time as we’ve been thinking and discussing this, I’ve been following the blog of Smashing Magazine which has some great in-depth articles revolving around online design. I first found Smashing Magazine when I stumbled upon their great collection of monthly desktop wallpaper calendars during one of my procrastinatory searches for an inspirational (and anti-procrastinatory) desktop image. I mention these guys because by chance they have published a great article on the wireframing stage of web design projects.

I’ve knocked up a quick wireframe outline for a possible new Cognicology.com web layout. We will pass it on to the peeps we know in the business and get comments/ideas from them on what they think of the arrangement of elements.

cognicology_wireframe

The other cool thing related to Smashing Magazine is that I’ve pre-ordered a copy of their upcoming book, The Smashing Book. To quote them directly:

The Smashing Book is a printed book about best practices in modern Web design. The book shares technical tips and best practices on coding, usability and optimization and explores how to create successful user interfaces and apply marketing principles to increase conversion rates. It also shows how to get the most out of typography, color and branding so that you end up with intuitive and effective Web designs. And lastly, you will also get a peek behind the curtains of Smashing Magazine.

The book is due out late September, and they are giving a pre-order discount of 20% off the price of the book. Check it out here.