Why I use Dropbox, and why you should too: a (free) cloud-computing backup service

18 Apr 2010
No Comments »

About once every 12 months I get genuinely excited about some technology or piece of software, and I hit the apex of that cycle yesterday. If you have a self-structured working schedule,tend to write for our businesses/sites/studies/etc. from a variety of locations or you just love techie things; you should be getting excited too.

My biggest challenge (or at least a major one) over the last two and a half years of my PhD and online projects has been keeping my files in sync across my work computer, home computer and my travel laptop. I’ve tried a number of things such as working from a USB stick and using a software-style versioning control (ala CVS or Subversion). All methods I’ve tried have sucked.

USB sucks, because the idea of having all of your critical files on something that is inherently lose-able (esp. if you are me) is a bad idea. The stop-gap solution is to copy files from USB to HDD and back: Good luck keeping that all in sync.

CVS/Subversion suck because I am trying to clumsily use a software versioning system for a task that it is not optimised for. These technologies don’t handle file system structural changes too well, and forgetting to commit a change can screw things up royally.

I figured that I would look in to the cloud computing side of things, as the idea of having a centralised ‘cloud’ of files that my various computers (satellite cloudettes) had a synchronised copy of seemed ideal.

I tried a few different services, including Ubuntu One, and settled with Dropbox. It offers the same usage allowance as Ubuntu One, but has clients for Mac (incl. iPhone app), Windows and various Linux distros, whereas Ubuntu One is only for Ubuntu installations.

I also have an Android-based phone (HTC Magic) and an Android app for Dropbox is coming out in the next couple of months.

Anyway, the deal is that there is a free account that will allow you to sync 2Gb of files, $10/month for 50Gb and $20/month for 100Gb. Needless to say, for most peoples (e.g. me) needs 2Gb is more than adequate. You choose which folders on your computer(s) are on the cloud.

Obviously all files are also stored offline allowing you to access them, which also keeps your data pretty safe. You can even store files in a special ‘public’ folder, allowing you to give people a http URL to download the file from. Pretty stylin’.

Anyway, here is an invite link to try it out. This link will give both you and me an extra 250Mb allowance, which is a nice little bonus to get started with!

https://www.dropbox.com/referrals/NTQwODUyNDY5

CMap3D featured on the GMOD website, and at PAG18

22 Jan 2010
No Comments »

One of my applications from my PhD, CMap3D has featured on the GMOD project’s news page. It even has its own GMOD wiki page too.

Cmap3D screenshot

CMap3D is a 3D visualisation tool for comparative genetic/physical maps. The way that it works is by interfacing with data from an existing CMap comparative mapping installation. CMap is a GMOD application and by association CMap3D is becoming somewhat linked to GMOD, with the mid to long-term goal to have CMap3D become part of the GMOD project.

I returned last weekend from the annual Plant and Animal Genome conference, hosted in San Diego. One of the interactions from the week I enjoyed most was meeting with a number of people involved in the GMOD project. GMOD is an opensource project that strives to collect a number of interacting bioinformatics tools focused on the visualisation and management of data relating to the genomes of any and all organisms (Generic Model Organism Database).

And on a final CMap3D note, I also had a Bioinformatics paper on CMap3D accepted earlier this year.

Sixth-sense: where the information superhighway meets the streets

10 Nov 2009
No Comments »

This is amazingly Cool, and definitely with a capital C. Pattie Maes and Pranav Mistry from MIT showcase Sixth Sense in this TED talk (video below). Sixth Sense is an augmented reality device that takes information from the net that is contextually relevant to what is currently in front of you, and seamlessly integrates it in to your viewing space.

The device works using a small camera to track movement and a projector to display information on any surface you present (from the wall to your hand).

Imagine picking up a book in the book store and having the Amazon.com or Goodreads.com reader rating projected on its cover (and reviews projected on the blank inner sleeve), a clock projected on to your wrist or a picture taken by making a square around your subject of choice with your hands. All of these are demonstrated in the below video.

And the best bit? Sixth Sense is going open source. I am so going to be one of the first in line for this.

Brisbane Riverfire 2009 fireworks: Drive-thru style

28 Oct 2009
No Comments »

I just re-found this video from the 2009 Brisbane Riverfire fireworks back in September. I uploaded it ages ago to YouTube but forgot to link to it! It was taken whilst driving along the Riverside Expressway from the Captain Cook Bridge in Brisbane – we hit the Bridge right on 19:00 when the fireworks started – best vantage point ever!

Why everybody should always have a notepad with them, always

22 Oct 2009
1 Comment »

I recently read an article by Clive Thompson from Wired Magazine entitled Why Idling Mind Is Mother of Invention (thanks @janerawson). The super-brief summary of the article is that, contrary to popular belief, daydreaming and procrastination (hereby labeled ‘mental drift’) are actually crucial to solving complex problems and hence, productive.

As somebody who works in a fairly technical and creative industry, I whole-heartedly agree with the sentiment.

You dream, I dream, everybody daydreams

Notepad Luv

To go in to a little more detail, Clive talks about how brain scientists have shown that the areas of the brain responsible for long-term memory processing and problem-solving kick into overdrive when our brains wander into mental drift land. This suggest that our brains are doing more then looking for a distraction from a boring task: it seems they may be utilising this time to store/access memories and solve nagging problems. This doesn’t seem too far-fetched. Most people can relate to the idea of having (at least partially) solved some nagging issue whilst off in la-la-land. Think the famous ‘Eureka’ moment of Archimedes in his bathtub (Granted, we tend not to run down the street nude after every great idea, but the parallel exists none-the-less).

So, the take-away message from this is that daydreaming – good. Forcing high-levels on concentration on a particular, probably boring, task – bad. The second thing the article suggests is that you should actively timetable your day to allow a little daydreaming time. Most people suggest that going for a long, many hours walk might be the best solution. However, as Clive correctly points out, this is not possible in most work environment. Instead, he suggests the fairground that is the social web might be the solution. He postulates that killing time on YouTube, Wikipedia, Facebook and web-games might be the electronic othologue to going for a walk along a path, through a wood, with nothing but your thoughts.

I vehemently disagree.

The problem with resources such as YouTube and the like is that they require moderately high levels of attention and concentration. I can honestly say that I have never gone ‘Archimedial’ whilst catching up with people on Facebook or watching Sesame Street reruns on YouTube. These things are too much like watching TV or playing video games – activities considered to be creativity-killers. I personally believe you need to have a degree of sensory deprivation and introspection to be truly creative.

So, anyway, what does all of this have to do with notepads?

Well, if you are in a creative work environment that doesn’t completely suck, you should have a certain degree of control over your movements throughout the day and a boss that doesn’t sit behind your chair whipping you in to action every minute of the working day. A 3 hour walk may be out of the question, but there are some things you can do.

  • STEP 1. Walk away from your computer!
  • STEP 2. Grab your trusty notepad, and a pen

I find that the computer is a big creativity killer for me. It is a device that supplies a saturation of sensory input (especially with today’s media-rich web environment) and encourages interaction, that in turn discourages introspection.

What I tend to do is grab my notepad, find somewhere fairly close to work but away from distraction (ideally a nice area with plenty of lighting). I work on a large campus so I will tend to head to a cafe or something similar – you might have a nice lunchroom, or even find a tree to sit under – whatever works for you. Then you can just sit down and do nothing – thinking about whatever pops into your head and mulling over the problems. If you are writing an article, think about the logical structure of the article and note dot-points for what you want to talk about (I structured this very article in my notepad this morning over breakfast). Draw flow diagrams for algorithms. Sketch your perfect partner. Hell, draw dragons if you want to.

The important thing is to have a notepad handy to write down your ideas. Why? Because ideas you have during a daydream can be just like the particulars of a real dream – once you are out of that mindset they can very quickly fade into oblivion.

My two most creative timeframes? Breakfast and work travel. I always lay out a great spread for breakfast and have my notepad with me. I also have my notepad (or at least my diary) with me when travelling on the train – public transport with an iPod plugged into your head can be heaven, introspectively speaking.

This is all well and good, but why should I always have my notepad with me?

Social idea explosionism

One of the great perks in my work is that I am surrounded by a bunch of very bright people who love what they do, know a lot about what they do, and come from a variety of disciplines. Some of them even wear shoes. Having meetings with energetic people that have similar passions and interests to your own often leads to a state that I call idea explosionism.

Ever been discussing a problem or idea with a friend or work colleague and entered that positive feedback loop where, bouncing off each others ideas, you come up with an outcome that is bigger and better then your original solution or idea? You might have even spawned a number of sub-ideas relating in some fashion to the original. This is idea explosionism. Think of it as brainstorming at a higher level of existence. Another analogy is that you are creating a multi-threaded consciousness, with each member of the conversation contributing an independent thread of thought and creativity.

The problem with idea explosionism is that it is exciting. You will often get so caught up in it all that any thought of taking notes is virtually thrown out the window. However, take notes you must. Some of the best ideas that I have ever come up with has been over coffee or lunch with a bunch of like-minded people – and in most cases I’ve only remembered the ones I’ve written down.

Administrivia: clear out that creative space!

Things are required to perform most actions. However, too many things can hinder action, or stop it all together. Consider this. To play a game of basketball (action) you need both a ball (thing) and some players (thing). However if you imagine that you cover an entire basketball court with balls and try to put 100 players on the court, a game of basketball will be extremely difficult at best, impossible at worst. I believe our brains are no different. From the perspective of the brain; facts, ideas, tasks and schedules are all things: like our players and balls they take up space. The former take space in your creative space or mental workshop, the latter on the basketball court. Creating solutions to problems and creating new ideas is an action, similar to playing a game of basketball. You need some ideas and facts to create, but too many can get in the way.

In short, the more things (facts, balls) cluttering our space (brain, court), the harder it is to perform actions (create, play ball).

This is where a notepad can help. To continue our basketball analogy, if we found there were too many balls and players on the court, we would put all the spare balls into a storage closet and put the excess players on the bench – clearing our space and allowing a game of basketball to be played. We can do the same with our minds. Let the notepad be your storage closet. Let your diary be your bench.

This idea of dumping all the tasks and ’spare ideas’ on to paper to clear the mind is not a new one. It is called, rather appropriately, mind dumping. The premise is that, by dumping all the things you need to do from your brain onto paper, that you no longer need to use your brain-power to keep a mental todo list running in your mind. The scheduling responsibility is left to your list or diary, leaving your mind free to do stuff we now know is important, such as daydreaming.

I’ve written at length on a mind dumping technique I created called mind clustering on Cognicology. Mind clustering is a categorical mind dumping technique. I’ve even created a simple instructional video on the mind-clustering technique that you can also find on Cognicology. The inspiration for mind clustering came from an earlier mind mapping article by Yaro Starak.

Take home message

So the take home message? Always have a notepad with you, always. Daydreams, idea explosionism and the need to dump ideas can happen anytime, anywhere: so grab a comfy couch and be prepared!

All you need is love, umm, i mean time… more time

08 Oct 2009
1 Comment »

‘All you need is love’

Bugger that, Beatles. That line (as well as bowl-cuts, safari suits and mustard-coloured linoleumed walls) might have cut it back in the 60’s but fast-forward to the 21st century and I think that you are a lot more likely to hear the muttered line of ‘All I need is (more) time’.

It would be fair to say that in this day and age people have a lot more freedom in their lives. They have jobs with flexible working hours, it is easier then ever to move up/down/around/across and through job positions and career options. This perceived freedom can definitely be empowering but as the late uncle of a certain webbed-friend of mine is quoted as saying,

“With great power comes great responsibility”.

Being self-motivated, self-promotional and ‘putting in the hours’ is now almost essential for even the most humble of career progressions. Gone are the days of the chai wallah -> delivery guy -> office chick -> mysterious middle manager -> executive managerette -> … -> profit career path (see what I did there with the crossing of languages, genders and gendered suffixes? – take THAT P.C. brigade); in are the days of intensive self-schooling, re-tooling, self-promotion, side-projects, entrepreneurism and (perplexingly) social media experts.

I am no exception to this general trend. I currently put a lot of my time, heart and effort into probably the biggest project of my life, my PhD. Doing a PhD is not a trivial undertaking and one of its biggest perks is the flexibility it affords my schedule. Now I am apparently a gemini and whatever stock you may hold in star signs I definitely fit the stereotype of getting easily bored and look for variety and challenge in my life. I am happiest when working on a number of different projects. To this end, as well as working on my PhD, I always have a number of side-projects running – the most major of these being Cognicology and the Wifi mapping project. There is barely enough time to share across these projects let alone leaving enough time aside for other activities such as networking, self-schooling, and maintaining relationships: it is kinda like trying to spread the remains of an almost-empty jar of vegemite (the 1.0 stuff, not that iSnack two-point-crap rubbish) on your mornings toast.

Have you ever been to Cold Rock? Visiting a cold rock store is my personal version of hell. Not only are they happy with providing an impossibly large variety of ice-cream flavours, but they insist on tempting you to add an even more impossiblier variety of ‘mix-ins’. This gives you, as the ice-creamee, literally thousands of possible ice-cream combinations! Presented with this variety and open-ended flexibility very nearly cripples me – I am over-my-head with choice, freedom and self-determination and drowning in it. I believe this is almost exactly similar to the problem people are faced with in their professional lives today: there is a strong focus on having freedom and flexibility to work on the projects we want and we are free to organise our schedule to suit our needs. Instead of giving us the time to do what we want to do and achieve, we end up working harder and inefficiently. Most of us are ill-prepared to deal with the time flexibility in modern life and, if presented with some free time, will spend 7/8th of it on facebook.

So how do I (and you, and we) survive is this procrastination-rich, time-deficit society? Well NASA are still ignoring my letters and well-drawn diagrams on how we could use the USS Enterprise to slow down the rotation of the earth to increase the average day length to something on the order of 36-48 hours. So I suppose we will have to settle with learning new techniques to improve our time management, reduce our levels of procrastination and effectively prioritise our tasks. I spend a non-trivial amount of optimising my day-to-day life. Something that I have found is that the fight against procrastination is 20% technique, and 80% attitude. To this end, Alborz and I write extensively about how you can improve your attitude to make yourself happier, optimistic and more productive on our site, Cognicology.com

Michael Shanks interview, MMORPG doom and Stargate Universe trailer

07 Sep 2009
3 Comments »

In my last post I wrote about the upcoming MMORPG Stargate Worlds. It will be interesting to see what happens and if the project is dead in the water or not – further research shows news of funding issues, staff cuts and shoddy ‘craftsmanship’. Even in the below interview with Michael Shanks he refers the the growth of the Stargate Franchise beyond the series with movies and ‘failed video games’.

Another cool Stargate related thing is the theatrical trailer for Stargate Universe was released over the weekend. I’m interested to see how this show pans out – it looks at first glance to be a darker show with more of a space drama feel: think Stargate cross Battlestar Galactica. It even has a Battlestar Galactica-esque premise: A bunch of explorers from a variety of backgrounds and nationalities are stuck on a spaceship roaming the ether, with no way of returning home. The spaceship in question is an Ancient ship on autopilot that is seeding stargates across a distant galaxy.

Check the trailer here:

Pass the open source please and a torrent of sociability

05 Sep 2009
No Comments »

I’ve come across a number of cool sites and projects over the last week, as well as read a number of really thought provoking articles so I figured that I would filter for the best (in my mind) and put them up here.

1. Hexagon.cc

Picture 1

A torrent search engine / tracker site that has a definite social media feel and focus – which is pretty trendy at the moment.

Apparently the site is foundered by, amongst others, one of the admins of the large torrent search engine IsoHunt. Hexagon.cc looks really interesting as it will allow people to start up their own social-sharing networks for torrents and videos. The site is really cleanly designed and seems to be focusing on the convenient sharing of torrent information for legitimate material. Looks really promising!

http://hexagon.cc

2. OS FLV (and FlowPlayer)

OSFLV.com

The open source, embeddable FLV player.

This player is great for embedding your own video content on your site or blog, without hosting your video material on a third-party website such as YouTube or Vimeo. Whilst I have no problem with either of those services (I use both quite regularly) sometimes it is nice to have your video hosted locally, and have more control over how it is played back (you can have videos start automatically, loop and even customise the ’static image’).

Another player that looks great (maybe even better) is FlowPlayer, but I’ve not played around with it too much yet.

http://www.osflv.com
http://www.flowplayer.org

3. Zero-S Electric Motorcycle

zeromotorcycles.com

Fully-electric street legal motorcycle.

Fairly-decent max speed (90kph) and mid-range ‘mileage’ (~80km) makes this look like a really promising green motorcycle solution. At that range and top speed it would be a pretty decent bike for intra-city riding, not so good for inter-city, given that most highways in Australia have a limit of about 100-110kph). Give it a few years and I imagine we’ll see bikes with highway compatible top speeds and a longer range. It takes about 4 hours to recharge – what I would like to see is ‘battery exchange programs’ at fuel stations for electric bikes.

http://www.zeromotorcycles.com/zero-s-specs.php

4. Stargate Worlds

stargateworlds.com

Being a big Stargate fan I was stoked to find out recently that their was an MMORPG being made for the Stargate universe! It looks as though it is in beta too, with a tabled release of 2009. I might even consider getting a Windows box up and running to play this game, reviews pending.

http://www.stargateworlds.com/

Aaand some interesting articles (ripped from Twitter)

Linux (and OSX) commands for working with FASTA files

02 Sep 2009
4 Comments »

When working with the genomics or molecular marker side of BIoinformatics, Bioinformaticians are faced (very) often with DNA (or RNA) sequence files in FASTA format. FASTA files can store a single sequence, or multiple sequences. To be able to access individual sequences or measure some metric of the sequence data, such as length, some form of manipulation of the files is usually required.

This post gives a set of unix commands to perform some common manipulations required of FASTA files. These commands should work using the BASH shell under most popular distributions of linux (I use Ubuntu and CentOS). They will also work in the OSX terminal and *SHOULD* work in Windows using software such as Cygwin.

The manipulations and metric measurements I cover in this article deal with:

  1. Splitting a FASTA file of multiple sequences into FASTA files of individual sequences
  2. Joining multiple FASTA files into a single, multi-sequence FASTA file
  3. List the sequence headers in a FASTA file
  4. Counting the number of sequence entities in a FASTA file
  5. Determining the length of the sequence in a FASTA file

BEFORE WE BEGIN
Where you see or (or a similar name in angled brackets), replace this with your input file of choice or the name of the output file you wish to create respectively.

The FASTA Format

sourced from http://www.nmpdr.org/

To give a super brief description, FASTA format was the ASCII file format used for sequence information for the application of the same name. Some time in bioinformatics world passed and now FASTA formatted files are used by a variety of Bioinformatics packages and is the de facto standard for storing sequence information in text files.

The FASTA format itself is very simple: A file can consist of one or more sequence elements, each headed by a free text header starting with the chevron ‘>’ character and ending with a newline ‘\n’ character.

e.g. for DNA sequence:

>sequence 1
ACCGTACGATACGATCGCATCGCTGACTCG
ACTTACGACGACGCANNNNACATCGATCGA
ACACTCAGCA
>sequence 2
CACGCATTATCATCGATCCTCAGCTCATCGA
ATACGTACCACAACTCGCATCTCAGTCAGAC
ACTCGTACGCTACGTACGCATGCATCAGATC
ATCCTATGCATGCATCGTACGCTAGACTCGA
ATCGATCGCATGCATACGTACGCAT

NOTE: The sequence itself may have newline characters throughout the sequence – these should be
stripped when using the sequence data.

Splitting a FASTA file of multiple sequences into FASTA files of individual sequences

This command will create as many files as there are member sequences in the same directory as the source file,
incrementally numbered with a .fasta extension. (e.g. for an input file with 5 member sequences, such as the Arabidopsis genome, it will output files 1.fasta to 5.fasta.

awk '/^>/{f=++d".fasta"} {print > f}' <inputFile>

Joining multiple FASTA files into a single, multi-sequence FASTA file

This is the reverse of the above and we will assume a few things. Firstly, you want to combine all fasta files in the current directory and, secondly, they all have the same extension (.fasta). Adapt to your needs if this is not the case!

cat *.fasta > <outputFile>

List the sequence headers in a FASTA file

grep ">" <inputFile>

Counting the number of sequence entities in a FASTA file

grep ">" <inputFile> | wc -l

Determining the length of the sequence in a FASTA file

This method will give the TOTAL sequence length of a FASTA file. This means that if your FASTA file has a number of sequence entries, it will return the sum of the length of each sequence entry. To get the length of individual entries you would first need to split the file into individual entries, or do it programatically: either using a homegrown method or a Bioinformatics library such as BioPerl.

grep -v ">" <inputFile> | tr -d [:space:] | wc -c

These are a few useful commands for performing some common and simple FASTA file manipulations without needing to resort to programatic methods. It may be worthwhile defining an alias or simple bashscript wrapper for the above commands, allowing you to type something like: fastaLength fastafile.fasta at the command line.

Cognicology re-revamp, wireframes and smashing books

01 Sep 2009
1 Comment »

book-3d-320pxIt’s been pretty hectic with the PhD and Cognicology.com this month: I’m trying to wrangle a trip over to the states in January for a conference related to my PhD, which has taken a fair amount of my time. It is amazing the loops you need to jump through to organise this sort of thing. Between trying to secure a talking position, apply for travel funding and contacting other institutes to visit and talk sciencey things with, I’ve been kept pretty busy. Adding to that, Alborz and I have also been pretty busy with organising and preparing videos for the Cognicology.com site which has been a blast. As exciting as my day-to-day life is (assuming exciting is a relative measure, and you consider paint drying to be an extreme sport) it isn’t really the reason for this post.

The new Cognicology.com design has been up for about a month now, and whilst the design is a definite improvement over the last design, it still isn’t our ideal layout. I actually had a meeting with Al today about the design of the site and we’ve both come to the conclusion that we want something that is a little more ‘full and exciting’ and a lot less minimalist. At around the same time as we’ve been thinking and discussing this, I’ve been following the blog of Smashing Magazine which has some great in-depth articles revolving around online design. I first found Smashing Magazine when I stumbled upon their great collection of monthly desktop wallpaper calendars during one of my procrastinatory searches for an inspirational (and anti-procrastinatory) desktop image. I mention these guys because by chance they have published a great article on the wireframing stage of web design projects.

I’ve knocked up a quick wireframe outline for a possible new Cognicology.com web layout. We will pass it on to the peeps we know in the business and get comments/ideas from them on what they think of the arrangement of elements.

cognicology_wireframe

The other cool thing related to Smashing Magazine is that I’ve pre-ordered a copy of their upcoming book, The Smashing Book. To quote them directly:

The Smashing Book is a printed book about best practices in modern Web design. The book shares technical tips and best practices on coding, usability and optimization and explores how to create successful user interfaces and apply marketing principles to increase conversion rates. It also shows how to get the most out of typography, color and branding so that you end up with intuitive and effective Web designs. And lastly, you will also get a peek behind the curtains of Smashing Magazine.

The book is due out late September, and they are giving a pre-order discount of 20% off the price of the book. Check it out here.